IGF-1--microRNA与血管疾病-英文.ppt

Click to edit Master title style,Click to edit Master text styles,Second level,Third level,Fourth level,Fifth level,*,IGF-1,microRNA and Vascular Disease,Yangxin Li,Ph.D,Texas Heart Institute,The University of Texas Health Science Center,Insulin-Like Growth Factor 1(IGF-1),IGF family(insulin,IGF-1 and IGF-2),Single-chain polypeptide(70 amino acid),Circulating IGF-1 is generated by liver under the control of growth hormone,and represents endocrine form,IGF-1 is synthesized by almost every tissue,and represents autocrine and paracrine forms,IGF-1 exerts all of its known physiological effects upon binding to IGF-1R,and the action of IGF-1 is modulated by IGFBPs,TK,TK,b,b,a,a,IGF-1,IGF Binding Protein,The Structure of IGF-1R,IGF,-,1R,IGF,-,1,P,P,P,IRS,-,1,P,PI3K,pAkt,pFKHR,pBad,and,Cytochrome C,Caspase activity,Inhibition of Apoptosis,CXCR4/SDF-1,Migration,Proliferation Or,Differentiation,Stat3,GSK-3,Smad,Telomerase,myocardin,MMP9/SCF,Potential Mechanisms of IGF-1s Effects,The Mechanisms of Atherosclerosis,oxLDL Decreases Mitochondrial Membrane Potential (,),Control,oxLDL,nLDL,Rh123 Intensity,Rh123 Intensity,(%Control),Control,oxLDL,nLDL,0,20,40,60,80,100,120,Effects of oxLDL,IGF-1,and overexpression of IGF-1R on cytosolic cytochrome C levels.,Li et al,Arterioscler Thromb Vasc Biol,.2003;23,2178-2184,Effects of AdIGF-1R on the expression of IGF-1R,pAkt,and pBad.,Li et al,Arterioscler Thromb Vasc Biol,.2003;23,2178-2184,CD29,CD90,CD106,CD34,Expression of Marker on MSC,SDF-1 Induced MSC Migration,(%Control),Control,IGF-1,PD98095,LY294002,Wortmannin,*,PD98095,#,LY294002,Wortmannin,CXCR4 Ab,IGF-1,#,IGF-1 Enhances Stem Cell Migration,Li et al,Biochem Biophy Res Commun,2007,356(3),780-784,The development of atherosclerosis is due to the loss of,equilibrium between injury and repair,and bone marrow-derived EPC play an important role in vascular repair.,Circulation,2005,112(17)II-87,IGF-1 Infusion Increases Circulating EPC,American Heart Association Young Investigator Award,2005,NCM,MSC/NCM,MSC/NCM+IGF-1R Ab,MSC/NCM+LY294002,MSC/NCM+PD98059,1.5 0.6%,5.5 0.3%,1.9 0.6%,2.1 0.5%,5.3 0.7%,#,*,&,IGF-1 Increase c-kit Expression in NCM,NCM,MSC/NCM,MSC/NCM,+IGF-1R Ab,MSC/NCM,+LY294002,MSC/NCM,+PD98059,C-kit Expression on NCM,(percentage),*,#,&,IGF-1 Increase c-kit Expression in NCM,miR-208 and Cardiac Growth,microRNA and Heart Function,microRNA and Angiogenesis,The Potential Mechanism of IGF-1 on c-kit Expression and Function,microRNA and Cardiovascular System,*,miRNA Processing Pathway,Dicer,Myocyte,enhancer factor(MEF),directs miR-1 and miR-133 expression,Serum response factor(SRF),Increases miR-133 expression,IGF-1?,miRNA Regulators,miR-221 and miR-222 Antagomirs attenuate the effects of IGF-1 infusion on EPC and c-kit,Antagomirs,single-stranded RNA oligonucleotides complementary to specific miRNA with chemical modification for stability and cholesterol conjugation for better delivery are well suited to block miRNA functions in small animals.It is essential to example specific miRNAs that target the perfect mixture of mRNAs encoding growth factors and signaling proteins to modulate angiogenesis in vivo.,IGF-1 and Angiotensin II,Cell Viability,(%Control),Cell Proliferation,(%Control),Protein/DNA Ratio,(%Control),The Differential effects of ang II in Quiescent and Non-Quiescent Cells,Li et al,Am J of Physiol,2006,290(5),H2116-23,Ang II increases blood pressure,and produces weight loss and muscle wasting.,P=pair fed,A=angiotensin II,J Clin Invest 2005,115(2),451-458,Generation of skeletal muscle-specific,expression of IGF-1,transgenic mice.,Skeletal muscle-specific,expression of IGF-1,prevents ang II induced,muscle weight loss,(preferential in fast-fiber,not in slow fiber),Tg=transgenic,WT=wild type,J Clin Invest 2005,115(2),451-458,Skeletal muscle-specific,expression of IGF-1,prevents ang II induced,muscle weight loss,through pAkt.,Tg=transgenic,WT=wild type,J Clin Invest 2005,115(2),451-458,Ang II-induced muscle loss is associated with reduced levels of pBad,increased cytochrome C release into the cytosolic fraction,and DNA fragmentation,.,Gastrocnemius lysates were used.,J Clin Invest 2005,115(2),451-458,Ang II,IGF-1,Akt,Caspase-3,Actin cleavage,Protein,degradation,Apoptosis,Atrophy,AT1R,microRNA155,IGF-1,Angiotensin II and AT1R,Bioinformatic analyses of microRNA155,that may target AT1R,miRanda,TargetScan,miR155,miR155,G Analysis,(-kcal/mol)of the 70 nucleotides flanking the 5 and 3,of AT1R 3 UTR regions,570 bp,G=-10.4,370 bp,G=-9.0,IGF-1,miR-155 and AT1R,Methods:,mirVana,miRNA,isolation,mirVana,qRT,-PCR,miRNA,Detection,5S,rRNA,as control.,Results:,IGF-1 increase miR155 expression,and decrease AT1R expression in VSMC.,Has-miR-206:IGF-1 Complementary,IGF1(NM_000618),Position 151-158 of IGF1 3UTR,5 GAAAUACACAAGUAAACAUUCCA,3 GGUGUGUGAAGGAAUGUAAGGU,Has-miR-1:IGF-1 Complementary,IGF1(NM_000618),Position 151-158 of IGF1 3UTR,5 GAAAUACACAAGUAAACAUUCCA,3 AUGUAUGAAGAAA-UGUAAGGU,miRNA,IGF-1,IGF-1R,miR-1,+,miR-206,+,miR-613,+,miR-409,+,miR-217,+,Bioinformatic analyses of miRNA,that may target IGF-1 and IGF-1R,Websites,Strategies to study miRNA function,Tool for miRNA Functional Analysis,Tool,Function,Pre-miR miRNA Precursor Molecules,Synthetic miRNA molecule for up-regulation of miRNA activity,Anti-miR miRNA inhibitors,Synthetic miRNA inhibitors that reduce miRNA activity,miRNA Expression Reporter Vector,Accurate,quantitative miRNA reporter vector to monitor miRNA activity,Summary,IGF-1 is a potent survival factor for vascular cells and stem cells,preventing oxLDL-induced mitochondrial dysfunction,cytochrome C release and apoptosis through a IGF-1R/PI3 kinase/Akt signaling pathway.,IGF-1 increase CXCR4 and migration of MSC.,IGF-1 infusion prevents the development of atherosclerosis in ApoE knockout mice via a marked anti-inflammatory effect,increased circulating endothelial progenitor cells,and c-kit expression(may be via miR-221 and miR-222).,Muscle-specific expression of IGF-1 blocks angiotensin II-induced skeletal muscle wasting,may be via miR-155.,miR-1,miR-206,miR-613,miR-409 and miR-217 may target IGF-1 and IGF-1R.,