miRNA-128-3p通过下调KLHDC8A的表达抑制胶质瘤细胞的恶性生物学行为.pdf

INTRODUCTIONGliomas are the deadliest brain malignancies and theirtreatment remains clinically challenging in spite of thecurrent advances in cancer therapies1,2.The molecularcomplexity3,high invasiveness,heterogeneity,andblood-brain barrier(BBB)penetrability4,as well as theunique immune environment of gliomas5all contribute toa poor prognosis of glioma patients.The recent NationalComprehensive Cancer Network guidelines(v1.2022)classified adult gliomas into 5 categories,namely adultglioma(WHO grade 1),oligodendroglioma(IDH mutantwith1p/19qco-deletion),IDH-mutantastrocytoma,glioblastoma(GBM),andintracranial/spinalependymoma.The histological features of these gliomasubtypesareanalyzedinconjunctionwiththeirmolecular diagnosis to provide prognostic confirmationfor more personalized therapies6.However,earlydiagnosis and prediction of the clinical behaviors,treatment responses,and prognosis of invasive gliomasremain challenging and require the discovery of moreeffective biomarkers.KLHDC8A,a member of the Kelch domain-containing(KLHDC)protein superfamily,is encoded bya gene located at the 1q32.1 locus7.Kelch-repeatproteins are important regulators of cellular processes(migration,morphogenesis,and interaction)and somemolecular mechanisms(gene activation and proteindegradation)8and participate in tumorigenesis andneurological dysfunctions9.Previous studies showed thatKLHDC8A expression was increased in gliomas inassociation with the WHO grade10and in glioblastomatissues11,but its association with the upstream regulatoryfactors hasnot beenfullyunderstood.Micro-RNAs(miRNAs)have been shown to regulatemRNA stability and translational turnover of their targetRNAsunderbothphysiologicalandpathologicalconditions12,13and participate in the regulation of a widevariety of cellular and biological processes14-16.AberrantmiRNA expressions have been observed in oncogeneactivation in several life-threatening cancers,includinggliomas17-20,suggesting the possibility of using miRNAsas biomarkers for cancer diagnosis and targets for cancertherapy.We previously demonstrated,by comparing mRNAand miRNA expression profiles between glioblastomaandpairedadjacenttissue,thatmiRNA-128-3pexpression was significantly reduced in glioblastoma andKLHDC8A mRNA was one of its targets in the generegulatory network21.We therefore hypothesized thatmiRNA-128-3p is capable of regulating KLHDC8AAbstract:Objective To determine whether miRNA-128-3p regulates malignant biological behavior of glioma cells by targetingKLHDC8A.Methods Dual-luciferase reporter assays,qRT-PCR and Western blotting were used to verify the targeting of miRNA-128-3p to KLHDC8A.Edu assay,flow cytometry,Transwell assay and would healing assay were used to determine the effects ofchanges in miRNA-128-3p and KLHDC8Aexpression levels on malignant behavior of glioma cells.Rescue experiment was carriedout to verify that miRNA-128-3p regulated glioma cell proliferation,apoptosis,invasion and migration by targeting KLHDC8A.Results The expression level of KLHDC8Awas significantly increased in high-grade glioma tissue and was closely related to a poorsurvival outcome of the patients.Overexpression of KLHDC8A promoted glioma cell proliferation,migration and invasion,andmiRNA-128-3p overexpression inhibited proliferative and metastatic capacities of glioma cells.Mechanistically,KLHDC8Aexpression was directly modulated by miRNA-128-3p,which,by targeting KLHDC8A,inhibited malignant behavior of gliomacells.Conclusion UpregulationofmiRNA-128-3pinhibitsuncontrolledgrowthofgliomacellsbynegativelyregulatingKLHDC8Aexpression and its downstream effectors,suggesting that the miRNA-128-3p-KLHDC8A axis may serve as a potential prognosticindicatorandatherapeutictargetfordevelopingnewstrategiesforgliomatreatment.Keywords:glioma;miRNA-128-3p;KLHDC8A;biomarker;migration;proliferationmiRNA-128-3p inhibits malignant behavior of glioma cells bydownregulating KLHDC8AexpressionYU Zhengtao1,LI Jiameng1,JIANG Junwen1,LI You1,LIN Long1,XIAYing1*,WANG Lei2*1Department of Neurosurgery,Affiliated Haikou Hospital of Xiangya School of Central South University,Haikou 570208,China;2Department ofNeurosurgery,Hunan Cancer Hospital and Affiliated Cancer Hospital of Xiangya School of Medicine,Central South University,Changsha410006,ChinaOriginalArticleReceived:2023-05-23Accepted:2023-09-18Supported by Hainan Provincial Natural Science Foundation ofChina(No.820MS163),Scientific Research Project of HunanProvincial Health Commission(No.20200709),and HainanCerebrovascular Diseases Clinical Medical Research Center(LCYX202206).*Correspondingauthors:XIAYing,E-mail:;WANGLei,E-mail:.J South Med Univ,2023,43(9):1447-1459doi 10.12122/j.issn.1673-4254.2023.09.011447expression in glioblastoma.In this study,we investigatedthe cross-talk between miRNA-128-3p and KLHDC8Ain glioma cells,and the results suggest that the oncogenicexpressionofKLHDC8Aisinstrumentalforthemalignant phenotype of glioblastoma and associated withpoortreatment responsesof thepatients.METHODSBioinformaticanalysisBioinformatic analysis was performed as describedpreviously21.Briefly,miRNA expression profile dataset(GSE90603)andtranscriptomeprofiledataset(GSE90598)weredownloadedfromcombinedmiRNA-mRNA microarray chips in the Gene ExpressionOmnibus(GEO)database.The expressions of miRNAand mRNA were detected using the platform GPL21582and GPL17692.The differentially expressed miRNAs(DEMs)and differentially expressed genes(DEGs)wereidentified using the R limma software package.FunRichwas used to perform functional enrichment analysis;themiRNAs and their target gene regulatory network wasconstructed usingCytoscape 3.6.1 software.Survival analysis and gliomagrading analysisThe Chinese Glioma Genome Atlas(CGGA)database(http:/ and survival analyses.This database of over 2000glioma tissue samples contains miRNA microarrays(198samples)and matched clinical data that can be used toassess the impact of certain miRNAs on glioma patientsurvival.The miRNA expression levels between grade IIand grade IV gliomas were analyzed using CGGAdatabase.The median expression value of each DEM inglioma specimens was calculated to define the highexpression(above the median)group and low expression(below the median)group.Combined with the prognosticresults obtained from the CGGA database(includingoverall survival data),Kaplan-Meier survival curves ofthe two groups of patients were drawn,and log-rank testwas used to evaluate the relationship between the geneexpression level and the patients survival.A P value lessthan 0.05wasconsideredstatisticallysignificant.Cell cultureHuman glioma lines U87-MG(#BNCC100646;BNCC,China)and U251(#BNCC337874;BNCC,China)andnormal human astrocytes(NHAs)(#QCB849;QCHENG,China)were cultured routinely in DMEM medium(#R8758,Sigma,USA)supplemented with 10%fetalbovine serum(FBS;Gibco,USA)and 1%Pen-Strep(#SV30010,Beyotime,China)at 37 in 5%CO2in ahumidified chamber.Cell transfectionOE-KLHDC8A,OE-NC,KLHDC8A siRNA,and siRNANC were purchased from RiboBio.miRNA-128-3pmimic,mimicNC,miRNA-128-3pinhibitor,andinhibitor NC were purchased from HonorGene.For celltransfection,the cells were seeded in a 6-well plate,andwhen the cell confluence reached 60%,the culturemedium was removed.95 L of serum-free culturemedium was added to each sterile centrifuge tube,followed by addition of 5 L of each of the 8 plasmids(ata concentration of 20 mol/L and 5 L of Lipofectamine2000 reagent(Invitrogen,USA).After gentle mixing,themixtures were incubated at room temperature for 20 min.In the 6-well plate,800 L of serum-free culture mediumwas added in each well,and the aforementioned mixtureswere added to each well and gently mixed.The plate wasincubated at 37 in 5%CO2for 6 h.Fresh completeculture medium was then changed,and the cells werefurther incubated for 48 h for subsequent analysis.Thesequences of KLHDC8A siRNAs and miRNA-128-3pmimicand inhibitorarelisted in Tab.1.NamemiRNA-128-3p mimicsmiRNA-128-3p inhibitorMimic NCInhibitor NCsiRNANCKLHDC8AsiRNA-1051KLHDC8AsiRNA-1553KLHDC8AsiRNA-1774Sequences(5-3)Sense:5-UCACAGUGAACCGGUCUCUUU-3Antisense:5-AGAGACCGGUUCACUGUGAUU-35-AAAGAGACCGGUUCACUGUGA-3Sense:5-UUCUCCGAACGUGUCACGUTT-3Antisense:5-ACGUGACACGUUCGGAGAATT-35-CAGUACUUUUGUGUAGUACAA-3Sense:5-UUCUCCGAACGUGUCACGUTT-3Antisense:5-ACGUGACACGUUCGGAGAATT-3Sense:5-GGAAGCGGAUCAUGGUGAUTT-3Antisense:5-AUCACCAUGAUCCGCUUCCTT-3Sense:5-GGACGUGUUCGACAUGGAATT-3Antisense:5-UUCCAUGUCGAACACGUCCTT-3Sense:5-GCUCCAGCAUAGUCGUCAATT-3Antisense:5-UUGACGACUAUGCUGGAGCTT-3Tab.1 Sequences of miRNA-128-3p mimic and inhibitor and 3 KLHDC8A siRNAsused in this studyJ South Med Univ,2023,43(9):1447-1459http:/www.j-1448Quantitativereal-time-PCR(qRT-PCR)The total RNA was extracted from the cells using TRIzolmethod(Thermo,USA).The miRNAs were reversetranscribed into complementary DNA(cDNA)usingSuper RT reagent,and compatible SYBR Master mix(#CW2569,and#CW2601,CWBIO,China)was used forqRT-PCR following the manufacturers instructions.SnU6and-actinservedasthereferencesforquantitationofmiRNAandKLHDC8AmRNAexpressions,respectively.Theprimerpairsweresynthesized by Shanghai Genomics Institute(Tab.2).Theamplification system consisted of 2 L cDNA,1 LPrimer R,1 L Primer F,11 L ddH2O,and 15 L 2SYBGREEN PCR Master Mix.Each of the 30 L mixturefor each sample was added in 3 wells(10 L per well)forqRT-PCR detection.The amplification was initiated at95 for 10 min,followed by 40 cycles of 95 for 15 sand 60 for 30 s.The 2-Ctmethod was used todetermine the relative expressions of the mRNAs andmiRNAs.WesternblottingfordetectingKLHDC8AproteinexpressionCell lysates were prepared in RIPA(#P0013B,Beyotime,China)buffer,and the protein concentrations weremeasured using a BCA kit(Thermo,USA).After 10%SDS-PAGE,the total proteins were transferred from thegel to polyvinylidene difluoride membranes,which wereblocked with 5%skim milk for 1.5 h at room temperature.The membranes were then incubated with the primaryantibodies anti-KLHDC8A(ab235419,Abcam,UK)andanti-actin(#66009-1-Ig,Ptg,USA)overnight at 4,and then with the secondary antibodies HRP-conjugatedgoat anti-mouse IgG(1:5000;SA00001-1,Proteintech,US)and HRP-conjugated goat anti-rabbit lgG(1:6000;SA00001-2,Proteintech,US)for1hatroomtemperature.The protein bands were visualized byexposure for 60 s to enhanced chemiluminescence(ECL)reagent.Luciferasereporter assayThe coding sequence of miRNA-128-3p was obtainedfrom TargetScan(http:/www.targetscan.org/)and MiRDB(http:/www.mirdb.org/miRDB/).The pmirGLO vector(Promega,USA)was used for cloning the wild-type(WT)and mutant(MUT)KLHDC8A sequences to assess thebinding of miRNA-128-3p to its target mRNA.Thevectors were subsequently transfected into HEK-293Acells,in parallel to miRNA mimic,inhibitor and negativecontrol,and luciferase activity was measured 48 h laterusing the luciferase reporter activity assay kit(Promega,USA).EdU assayThe EdU Apollo-567 kit(RiboBio,China)was used forcell staining with 50 mol/L EdU overnight,followed byfixingandimagingfollowingthemanufacturersinstructions.For quantitative analysis,3 visual fieldswere randomly captured,and the cell nuclei werecounterstainedwith DAPI.Apoptosis analysisThe cells transfected with the plasmids or miRNAs werestained with 5 L Annexin V-APC and 5 L propidiumiodide(#KGA108,KeyGen BioTECH,China)in thebinding buffer for 10 min in darkness.Flow cytometrywas performed for each sample in triplicates to detectbothlateandearly apoptotic cells.Wound-healingassaySix hours after transfection,U87-MG and U251 cellswere suspended in FBS-free medium and seeded at thedensity of 5 105cells/well into 6-well plates,and avertical scratch was made using a sterile pipette tip.Thecells were cultured for another 24-48 h,and the width ofthe wound was photographed at 0,24,and 48 h.Thehealing abilities of the glioma cells were assessed bymeasuring the area ofmigrating cells.Transwell assayTranswell assay was used to evaluate the invasion andmigration abilities of the cells.The upper layers of theTranswellplateswerecoatedwithMatrigel(BDBiosciences,Franklin Lakes,NJ,USA)at the finalconcentration of 200 g/well,diluted with serum-freeDMEM medium,and the plates were incubated at 37 for 30 min.Following coating,the cells were digestedwith trypsin and resuspended in 100 L serum-freemedium(2 106cells/mL).The cell suspensions wereadded into the upper layer,and 500 L mediumcontaining10%FBSwasaddedintothelowercompartment.The cells were cultured in a cell incubatorat 37 for 48 h in 5%CO2for 48 h,and the invaded ormigrated cells in the lower compartment were fixed in 4%paraformaldehyde and stained with 0.1%crystal violet.The cells inside the upper layer were removed usingcotton balls,while the cells that penetrated the upperlayer were counted under a microscope.Finally,500 Lof 10%acetic acid was added to the lower compartment,Genehsa-miR-128-3pGAPDHKLHDC8A-actinU6SequencesTCACAGTGAACCGGTCTCTTTForward:ACAGCCTCAAGATCATCAGCReverse:GGTCATGAGTCCTTCCACGATForward:TTCTCCAGCTTTGTGACCCTReverse:TTCCATGTCGAACACGTCCAForward:ACCCTGAAGTACCCCATCGAGReverse:AGCACAGCCTGGATAGCAACForward:CTCGCTTCGGCAGCACAReverse:AACGCTTCACGAATTTGCGTTab.2 Primer sequences for reverse transcription quantitativepolymerase chain reactionhttp:/www.j-J South Med Univ,2023,43(9):1447-14591449and the absorbance value at 550 nm was measured with amicroplate reader.Statistical analysisThe data were analyzed using GraphPad Prism 8.0.Alldata were presented as MeanSD.Shapiro-Wilk test andLevenes test were performed to assess the normality andhomogeneity of variances,respectively.One-way analysisof variance(ANOVA)was used to determine statisticaldifferences among different groups.Two-way ANOVAwasemployedtodeterminethesignificanceofdifferences between different time points and differentgroups.A P value less than 0.05 was considered toindicateastatisticallysignificant difference.RESULTSKLHDC8AisupregulatedwithWHO Grade ofgliomasTo explore the correlation between WHO grades andKLHDC8Aexpressioningliomas,wecomparedKLHDC8A expressions among patients with differentWHO grades(II-IV)based on data from the CGGAdatabase.The results showed that KLHDC8A expressionwas significantly higher in high-grade(WHO grade IIIand IV)than in low-grade(WHO grade II)gliomas(Fig.1A).A higher KLHDC8A expression level wasassociated with a poorer overall survival(OS)rate of theglioma patients,irrespective of the tumor grade(Fig.1B).The results of RT-PCR and Western blotting showed thatthe expression of KLHDC8A was significantly elevated inU251 and U87 cells as compared with that of NHAs(Fig.1C).These results indicate that altered expressionsof KLHDC8A might beinvolvedingliomapathogenesis.Fig.1 Analysis of the expression of KLHDC8A in glioma tissues and glioma cell lines.A:KLHDC8A expression ispositively correlated with glioma grade.B:Prognostic value of KLHDC8A in gliomas of all grades.C:Proteinexpressions of KLHDC8A in glioma cell lines(U251 and U87 cells)detected with Western blotting(*P0.05 vs NHAsgroup).D:qRT-PCR and Western blotting of KLHDC8A mRNA and protein l